perlretut(1) - phpMan

Command: man perldoc info search(apropos)  


PERLRETUT(1)                     Perl Programmers Reference Guide                    PERLRETUT(1)

NAME
       perlretut - Perl regular expressions tutorial

DESCRIPTION
       This page provides a basic tutorial on understanding, creating and using regular
       expressions in Perl.  It serves as a complement to the reference page on regular
       expressions perlre.  Regular expressions are an integral part of the "m//", "s///", "qr//"
       and "split" operators and so this tutorial also overlaps with "Regexp Quote-Like
       Operators" in perlop and "split" in perlfunc.

       Perl is widely renowned for excellence in text processing, and regular expressions are one
       of the big factors behind this fame.  Perl regular expressions display an efficiency and
       flexibility unknown in most other computer languages.  Mastering even the basics of
       regular expressions will allow you to manipulate text with surprising ease.

       What is a regular expression?  At its most basic, a regular expression is a template that
       is used to determine if a string has certain characteristics.  The string is most often
       some text, such as a line, sentence, web page, or even a whole book, but it doesn't have
       to be.  It could be binary data, for example.  Biologists often use Perl to look for
       patterns in long DNA sequences.

       Suppose we want to determine if the text in variable, $var contains the sequence of
       characters "mushroom" (blanks added for legibility).  We can write in Perl

        $var =~ m/mushroom/

       The value of this expression will be TRUE if $var contains that sequence of characters
       anywhere within it, and FALSE otherwise.  The portion enclosed in '/' characters denotes
       the characteristic we are looking for.  We use the term pattern for it.  The process of
       looking to see if the pattern occurs in the string is called matching, and the "=~"
       operator along with the "m//" tell Perl to try to match the pattern against the string.
       Note that the pattern is also a string, but a very special kind of one, as we will see.
       Patterns are in common use these days; examples are the patterns typed into a search
       engine to find web pages and the patterns used to list files in a directory, e.g., ""ls
       *.txt"" or ""dir *.*"".  In Perl, the patterns described by regular expressions are used
       not only to search strings, but to also extract desired parts of strings, and to do search
       and replace operations.

       Regular expressions have the undeserved reputation of being abstract and difficult to
       understand.  This really stems simply because the notation used to express them tends to
       be terse and dense, and not because of inherent complexity.  We recommend using the "/x"
       regular expression modifier (described below) along with plenty of white space to make
       them less dense, and easier to read.  Regular expressions are constructed using simple
       concepts like conditionals and loops and are no more difficult to understand than the
       corresponding "if" conditionals and "while" loops in the Perl language itself.

       This tutorial flattens the learning curve by discussing regular expression concepts, along
       with their notation, one at a time and with many examples.  The first part of the tutorial
       will progress from the simplest word searches to the basic regular expression concepts.
       If you master the first part, you will have all the tools needed to solve about 98% of
       your needs.  The second part of the tutorial is for those comfortable with the basics and
       hungry for more power tools.  It discusses the more advanced regular expression operators
       and introduces the latest cutting-edge innovations.

       A note: to save time, "regular expression" is often abbreviated as regexp or regex.
       Regexp is a more natural abbreviation than regex, but is harder to pronounce.  The Perl
       pod documentation is evenly split on regexp vs regex; in Perl, there is more than one way
       to abbreviate it.  We'll use regexp in this tutorial.

       New in v5.22, "use re 'strict'" applies stricter rules than otherwise when compiling
       regular expression patterns.  It can find things that, while legal, may not be what you
       intended.

Part 1: The basics
   Simple word matching
       The simplest regexp is simply a word, or more generally, a string of characters.  A regexp
       consisting of just a word matches any string that contains that word:

           "Hello World" =~ /World/;  # matches

       What is this Perl statement all about? "Hello World" is a simple double-quoted string.
       "World" is the regular expression and the "//" enclosing "/World/" tells Perl to search a
       string for a match.  The operator "=~" associates the string with the regexp match and
       produces a true value if the regexp matched, or false if the regexp did not match.  In our
       case, "World" matches the second word in "Hello World", so the expression is true.
       Expressions like this are useful in conditionals:

           if ("Hello World" =~ /World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       There are useful variations on this theme.  The sense of the match can be reversed by
       using the "!~" operator:

           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }

       The literal string in the regexp can be replaced by a variable:

           my $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       If you're matching against the special default variable $_, the "$_ =~" part can be
       omitted:

           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       And finally, the "//" default delimiters for a match can be changed to arbitrary
       delimiters by putting an 'm' out front:

           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the paired '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                        # '/' becomes an ordinary char

       "/World/", "m!World!", and "m{World}" all represent the same thing.  When, e.g., the quote
       ('"') is used as a delimiter, the forward slash '/' becomes an ordinary character and can
       be used in this regexp without trouble.

       Let's consider how different regexps would match "Hello World":

           "Hello World" =~ /world/;  # doesn't match
           "Hello World" =~ /o W/;    # matches
           "Hello World" =~ /oW/;     # doesn't match
           "Hello World" =~ /World /; # doesn't match

       The first regexp "world" doesn't match because regexps are by default case-sensitive.  The
       second regexp matches because the substring 'oW' occurs in the string "HelloWorld".  The
       space character ' ' is treated like any other character in a regexp and is needed to match
       in this case.  The lack of a space character is the reason the third regexp 'oW' doesn't
       match.  The fourth regexp ""World "" doesn't match because there is a space at the end of
       the regexp, but not at the end of the string.  The lesson here is that regexps must match
       a part of the string exactly in order for the statement to be true.

       If a regexp matches in more than one place in the string, Perl will always match at the
       earliest possible point in the string:

           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more points you need to know about.
       First of all, not all characters can be used "as-is" in a match.  Some characters, called
       metacharacters, are generally reserved for use in regexp notation.  The metacharacters are

           {}[]()^$.|*+?-#\

       This list is not as definitive as it may appear (or be claimed to be in other
       documentation).  For example, "#" is a metacharacter only when the "/x" pattern modifier
       (described below) is used, and both "}" and "]" are metacharacters only when paired with
       opening "{" or "[" respectively; other gotchas apply.

       The significance of each of these will be explained in the rest of the tutorial, but for
       now, it is important only to know that a metacharacter can be matched as-is by putting a
       backslash before it:

           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also backslashed, because it is used to
       delimit the regexp.  This can lead to LTS (leaning toothpick syndrome), however, and it is
       often more readable to change delimiters.

           "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

       The backslash character '\' is a metacharacter itself and needs to be backslashed:

           'C:\WIN32' =~ /C:\\WIN/;   # matches

       In situations where it doesn't make sense for a particular metacharacter to mean what it
       normally does, it automatically loses its metacharacter-ness and becomes an ordinary
       character that is to be matched literally.  For example, the '}' is a metacharacter only
       when it is the mate of a '{' metacharacter.  Otherwise it is treated as a literal RIGHT
       CURLY BRACKET.  This may lead to unexpected results.  "use re 'strict'" can catch some of
       these.

       In addition to the metacharacters, there are some ASCII characters which don't have
       printable character equivalents and are instead represented by escape sequences.  Common
       examples are "\t" for a tab, "\n" for a newline, "\r" for a carriage return and "\a" for a
       bell (or alert).  If your string is better thought of as a sequence of arbitrary bytes,
       the octal escape sequence, e.g., "\033", or hexadecimal escape sequence, e.g., "\x1B" may
       be a more natural representation for your bytes.  Here are some examples of escapes:

           "1000\t2000" =~ m(0\t2)   # matches
           "1000\n2000" =~ /0\n20/   # matches
           "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
           "cat"   =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
                                        # to spell cat

       If you've been around Perl a while, all this talk of escape sequences may seem familiar.
       Similar escape sequences are used in double-quoted strings and in fact the regexps in Perl
       are mostly treated as double-quoted strings.  This means that variables can be used in
       regexps as well.  Just like double-quoted strings, the values of the variables in the
       regexp will be substituted in before the regexp is evaluated for matching purposes.  So we
       have:

           $foo = 'house';
           'housecat' =~ /$foo/;      # matches
           'cathouse' =~ /cat$foo/;   # matches
           'housecat' =~ /${foo}cat/; # matches

       So far, so good.  With the knowledge above you can already perform searches with just
       about any literal string regexp you can dream up.  Here is a very simple emulation of the
       Unix grep program:

           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D

           % chmod +x simple_grep

           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is the standard way to invoke a
       perl program from the shell.  "$regexp=shift;" saves the first command line argument as
       the regexp to be used, leaving the rest of the command line arguments to be treated as
       files.  "while(<>)" loops over all the lines in all the files.  For each line,
       "printif/$regexp/;" prints the line if the regexp matches the line.  In this line, both
       "print" and "/$regexp/" use the default variable $_ implicitly.

       With all of the regexps above, if the regexp matched anywhere in the string, it was
       considered a match.  Sometimes, however, we'd like to specify where in the string the
       regexp should try to match.  To do this, we would use the anchor metacharacters '^' and
       '$'.  The anchor '^' means match at the beginning of the string and the anchor '$' means
       match at the end of the string, or before a newline at the end of the string.  Here is how
       they are used:

           "housekeeper" =~ /keeper/;    # matches
           "housekeeper" =~ /^keeper/;   # doesn't match
           "housekeeper" =~ /keeper$/;   # matches
           "housekeeper\n" =~ /keeper$/; # matches

       The second regexp doesn't match because '^' constrains "keeper" to match only at the
       beginning of the string, but "housekeeper" has keeper starting in the middle.  The third
       regexp does match, since the '$' constrains "keeper" to match only at the end of the
       string.

       When both '^' and '$' are used at the same time, the regexp has to match both the
       beginning and the end of the string, i.e., the regexp matches the whole string.  Consider

           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           ""       =~ /^$/;          # ^$ matches an empty string

       The first regexp doesn't match because the string has more to it than "keep".  Since the
       second regexp is exactly the string, it matches.  Using both '^' and '$' in a regexp
       forces the complete string to match, so it gives you complete control over which strings
       match and which don't.  Suppose you are looking for a fellow named bert, off in a string
       by himself:

           "dogbert" =~ /bert/;   # matches, but not what you want

           "dilbert" =~ /^bert/;  # doesn't match, but ..
           "bertram" =~ /^bert/;  # matches, so still not good enough

           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just as easily use the string
       comparison "$stringeq'bert'" and it would be more efficient.   The  "^...$" regexp really
       becomes useful when we add in the more powerful regexp tools below.

   Using character classes
       Although one can already do quite a lot with the literal string regexps above, we've only
       scratched the surface of regular expression technology.  In this and subsequent sections
       we will introduce regexp concepts (and associated metacharacter notations) that will allow
       a regexp to represent not just a single character sequence, but a whole class of them.

       One such concept is that of a character class.  A character class allows a set of possible
       characters, rather than just a single character, to match at a particular point in a
       regexp.  You can define your own custom character classes.  These are denoted by brackets
       "[...]", with the set of characters to be possibly matched inside.  Here are some
       examples:

           /cat/;       # matches 'cat'
           /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
           /item[0123456789]/;  # matches 'item0' or ... or 'item9'
           "abc" =~ /[cab]/;    # matches 'a'

       In the last statement, even though 'c' is the first character in the class, 'a' matches
       because the first character position in the string is the earliest point at which the
       regexp can match.

           /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                                # 'yes', 'Yes', 'YES', etc.

       This regexp displays a common task: perform a case-insensitive match.  Perl provides a way
       of avoiding all those brackets by simply appending an 'i' to the end of the match.  Then
       "/[yY][eE][sS]/;" can be rewritten as "/yes/i;".  The 'i' stands for case-insensitive and
       is an example of a modifier of the matching operation.  We will meet other modifiers later
       in the tutorial.

       We saw in the section above that there were ordinary characters, which represented
       themselves, and special characters, which needed a backslash '\' to represent themselves.
       The same is true in a character class, but the sets of ordinary and special characters
       inside a character class are different than those outside a character class.  The special
       characters for a character class are "-]\^$" (and the pattern delimiter, whatever it is).
       ']' is special because it denotes the end of a character class.  '$' is special because it
       denotes a scalar variable.  '\' is special because it is used in escape sequences, just
       like above.  Here is how the special characters "]$\" are handled:

          /[\]c]def/; # matches ']def' or 'cdef'
          $x = 'bcr';
          /[$x]at/;   # matches 'bat', 'cat', or 'rat'
          /[\$x]at/;  # matches '$at' or 'xat'
          /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

       The last two are a little tricky.  In "[\$x]", the backslash protects the dollar sign, so
       the character class has two members '$' and 'x'.  In "[\\$x]", the backslash is protected,
       so $x is treated as a variable and substituted in double quote fashion.

       The special character '-' acts as a range operator within character classes, so that a
       contiguous set of characters can be written as a range.  With ranges, the unwieldy
       "[0123456789]" and "[abc...xyz]" become the svelte "[0-9]" and "[a-z]".  Some examples are

           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a Perl variable name

       If '-' is the first or last character in a character class, it is treated as an ordinary
       character; "[-ab]", "[ab-]" and "[a\-b]" are all equivalent.

       The special character '^' in the first position of a character class denotes a negated
       character class, which matches any character but those in the brackets.  Both "[...]" and
       "[^...]" must match a character, or the match fails.  Then

           /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                      # all other 'bat', 'cat, '0at', '%at', etc.
           /[^0-9]/;  # matches a non-numeric character
           /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

       Now, even "[0-9]" can be a bother to write multiple times, so in the interest of saving
       keystrokes and making regexps more readable, Perl has several abbreviations for common
       character classes, as shown below.  Since the introduction of Unicode, unless the "/a"
       modifier is in effect, these character classes match more than just a few characters in
       the ASCII range.

       o   "\d" matches a digit, not just "[0-9]" but also digits from non-roman scripts

       o   "\s" matches a whitespace character, the set "[\ \t\r\n\f]" and others

       o   "\w" matches a word character (alphanumeric or '_'), not just "[0-9a-zA-Z_]" but also
           digits and characters from non-roman scripts

       o   "\D" is a negated "\d"; it represents any other character than a digit, or "[^\d]"

       o   "\S" is a negated "\s"; it represents any non-whitespace character "[^\s]"

       o   "\W" is a negated "\w"; it represents any non-word character "[^\w]"

       o   The period '.' matches any character but "\n" (unless the modifier "/s" is in effect,
           as explained below).

       o   "\N", like the period, matches any character but "\n", but it does so regardless of
           whether the modifier "/s" is in effect.

       The "/a" modifier, available starting in Perl 5.14,  is used to restrict the matches of
       "\d", "\s", and "\w" to just those in the ASCII range.  It is useful to keep your program
       from being needlessly exposed to full Unicode (and its accompanying security
       considerations) when all you want is to process English-like text.  (The "a" may be
       doubled, "/aa", to provide even more restrictions, preventing case-insensitive matching of
       ASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign" would caselessly match
       a "k" or "K".)

       The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of bracketed
       character classes.  Here are some in use:

           /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
           /[\d\s]/;         # matches any digit or whitespace character
           /\w\W\w/;         # matches a word char, followed by a
                             # non-word char, followed by a word char
           /..rt/;           # matches any two chars, followed by 'rt'
           /end\./;          # matches 'end.'
           /end[.]/;         # same thing, matches 'end.'

       Because a period is a metacharacter, it needs to be escaped to match as an ordinary
       period. Because, for example, "\d" and "\w" are sets of characters, it is incorrect to
       think of "[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is the same as "[^\w]", which is the
       same as "[\W]". Think DeMorgan's laws.

       In actuality, the period and "\d\s\w\D\S\W" abbreviations are themselves types of
       character classes, so the ones surrounded by brackets are just one type of character
       class.  When we need to make a distinction, we refer to them as "bracketed character
       classes."

       An anchor useful in basic regexps is the word anchor "\b".  This matches a boundary
       between a word character and a non-word character "\w\W" or "\W\w":

           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string

       Note in the last example, the end of the string is considered a word boundary.

       For natural language processing (so that, for example, apostrophes are included in words),
       use instead "\b{wb}"

           "don't" =~ / .+? \b{wb} /x;  # matches the whole string

       You might wonder why '.' matches everything but "\n" - why not every character? The reason
       is that often one is matching against lines and would like to ignore the newline
       characters.  For instance, while the string "\n" represents one line, we would like to
       think of it as empty.  Then

           ""   =~ /^$/;    # matches
           "\n" =~ /^$/;    # matches, $ anchors before "\n"

           ""   =~ /./;      # doesn't match; it needs a char
           ""   =~ /^.$/;    # doesn't match; it needs a char
           "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

       This behavior is convenient, because we usually want to ignore newlines when we count and
       match characters in a line.  Sometimes, however, we want to keep track of newlines.  We
       might even want '^' and '$' to anchor at the beginning and end of lines within the string,
       rather than just the beginning and end of the string.  Perl allows us to choose between
       ignoring and paying attention to newlines by using the "/s" and "/m" modifiers.  "/s" and
       "/m" stand for single line and multi-line and they determine whether a string is to be
       treated as one continuous string, or as a set of lines.  The two modifiers affect two
       aspects of how the regexp is interpreted: 1) how the '.' character class is defined, and
       2) where the anchors '^' and '$' are able to match.  Here are the four possible
       combinations:

       o   no modifiers: Default behavior.  '.' matches any character except "\n".  '^' matches
           only at the beginning of the string and '$' matches only at the end or before a
           newline at the end.

       o   s modifier ("/s"): Treat string as a single long line.  '.' matches any character,
           even "\n".  '^' matches only at the beginning of the string and '$' matches only at
           the end or before a newline at the end.

       o   m modifier ("/m"): Treat string as a set of multiple lines.  '.' matches any character
           except "\n".  '^' and '$' are able to match at the start or end of any line within the
           string.

       o   both s and m modifiers ("/sm"): Treat string as a single long line, but detect
           multiple lines.  '.' matches any character, even "\n".  '^' and '$', however, are able
           to match at the start or end of any line within the string.

       Here are examples of "/s" and "/m" in action:

           $x = "There once was a girl\nWho programmed in Perl\n";

           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line

           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/sm; # matches, "." matches "\n"

       Most of the time, the default behavior is what is wanted, but "/s" and "/m" are
       occasionally very useful.  If "/m" is being used, the start of the string can still be
       matched with "\A" and the end of the string can still be matched with the anchors "\Z"
       (matches both the end and the newline before, like '$'), and "\z" (matches only the end):

           $x =~ /^Who/m;   # matches, "Who" at start of second line
           $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

           $x =~ /girl$/m;  # matches, "girl" at end of first line
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We now know how to create choices among classes of characters in a regexp.  What about
       choices among words or character strings? Such choices are described in the next section.

   Matching this or that
       Sometimes we would like our regexp to be able to match different possible words or
       character strings.  This is accomplished by using the alternation metacharacter '|'.  To
       match "dog" or "cat", we form the regexp "dog|cat".  As before, Perl will try to match the
       regexp at the earliest possible point in the string.  At each character position, Perl
       will first try to match the first alternative, "dog".  If "dog" doesn't match, Perl will
       then try the next alternative, "cat".  If "cat" doesn't match either, then the match fails
       and Perl moves to the next position in the string.  Some examples:

           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even though "dog" is the first alternative in the second regexp, "cat" is able to match
       earlier in the string.

           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match at the first string position, so the first alternative is
       the one that matches.  If some of the alternatives are truncations of the others, put the
       longest ones first to give them a chance to match.

           "cab" =~ /a|b|c/ # matches "c"
                            # /a|b|c/ == /[abc]/

       The last example points out that character classes are like alternations of characters.
       At a given character position, the first alternative that allows the regexp match to
       succeed will be the one that matches.

   Grouping things and hierarchical matching
       Alternation allows a regexp to choose among alternatives, but by itself it is
       unsatisfying.  The reason is that each alternative is a whole regexp, but sometime we want
       alternatives for just part of a regexp.  For instance, suppose we want to search for
       housecats or housekeepers.  The regexp "housecat|housekeeper" fits the bill, but is
       inefficient because we had to type "house" twice.  It would be nice to have parts of the
       regexp be constant, like "house", and some parts have alternatives, like "cat|keeper".

       The grouping metacharacters "()" solve this problem.  Grouping allows parts of a regexp to
       be treated as a single unit.  Parts of a regexp are grouped by enclosing them in
       parentheses.  Thus we could solve the "housecat|housekeeper" by forming the regexp as
       "house(cat|keeper)".  The regexp "house(cat|keeper)" means match "house" followed by
       either "cat" or "keeper".  Some more examples are

           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.

           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match

       Alternations behave the same way in groups as out of them: at a given string position, the
       leftmost alternative that allows the regexp to match is taken.  So in the last example at
       the first string position, "20" matches the second alternative, but there is nothing left
       over to match the next two digits "\d\d".  So Perl moves on to the next alternative, which
       is the null alternative and that works, since "20" is two digits.

       The process of trying one alternative, seeing if it matches, and moving on to the next
       alternative, while going back in the string from where the previous alternative was tried,
       if it doesn't, is called backtracking.  The term "backtracking" comes from the idea that
       matching a regexp is like a walk in the woods.  Successfully matching a regexp is like
       arriving at a destination.  There are many possible trailheads, one for each string
       position, and each one is tried in order, left to right.  From each trailhead there may be
       many paths, some of which get you there, and some which are dead ends.  When you walk
       along a trail and hit a dead end, you have to backtrack along the trail to an earlier
       point to try another trail.  If you hit your destination, you stop immediately and forget
       about trying all the other trails.  You are persistent, and only if you have tried all the
       trails from all the trailheads and not arrived at your destination, do you declare
       failure.  To be concrete, here is a step-by-step analysis of what Perl does when it tries
       to match the regexp

           "abcde" =~ /(abd|abc)(df|d|de)/;

       0. Start with the first letter in the string 'a'.

       1. Try the first alternative in the first group 'abd'.

       2.  Match 'a' followed by 'b'. So far so good.

       3.  'd' in the regexp doesn't match 'c' in the string - a dead end.  So backtrack two
       characters and pick the second alternative in the first group 'abc'.

       4.  Match 'a' followed by 'b' followed by 'c'.  We are on a roll and have satisfied the
       first group. Set $1 to 'abc'.

       5 Move on to the second group and pick the first alternative 'df'.

       6 Match the 'd'.

       7.  'f' in the regexp doesn't match 'e' in the string, so a dead end.  Backtrack one
       character and pick the second alternative in the second group 'd'.

       8.  'd' matches. The second grouping is satisfied, so set $2 to 'd'.

       9.  We are at the end of the regexp, so we are done! We have matched 'abcd' out of the
       string "abcde".

       There are a couple of things to note about this analysis.  First, the third alternative in
       the second group 'de' also allows a match, but we stopped before we got to it - at a given
       character position, leftmost wins.  Second, we were able to get a match at the first
       character position of the string 'a'.  If there were no matches at the first position,
       Perl would move to the second character position 'b' and attempt the match all over again.
       Only when all possible paths at all possible character positions have been exhausted does
       Perl give up and declare "$string=~/(abd|abc)(df|d|de)/;" to be false.

       Even with all this work, regexp matching happens remarkably fast.  To speed things up,
       Perl compiles the regexp into a compact sequence of opcodes that can often fit inside a
       processor cache.  When the code is executed, these opcodes can then run at full throttle
       and search very quickly.

   Extracting matches
       The grouping metacharacters "()" also serve another completely different function: they
       allow the extraction of the parts of a string that matched.  This is very useful to find
       out what matched and for text processing in general.  For each grouping, the part that
       matched inside goes into the special variables $1, $2, etc.  They can be used just as
       ordinary variables:

           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }

       Now, we know that in scalar context, "$time=~/(\d\d):(\d\d):(\d\d)/" returns a true or
       false value.  In list context, however, it returns the list of matched values
       "($1,$2,$3)".  So we could write the code more compactly as

           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

       If the groupings in a regexp are nested, $1 gets the group with the leftmost opening
       parenthesis, $2 the next opening parenthesis, etc.  Here is a regexp with nested groups:

           /(ab(cd|ef)((gi)|j))/;
            1  2      34

       If this regexp matches, $1 contains a string starting with 'ab', $2 is either set to 'cd'
       or 'ef', $3 equals either 'gi' or 'j', and $4 is either set to 'gi', just like $3, or it
       remains undefined.

       For convenience, Perl sets $+ to the string held by the highest numbered $1, $2,... that
       got assigned (and, somewhat related, $^N to the value of the $1, $2,... most-recently
       assigned; i.e. the $1, $2,... associated with the rightmost closing parenthesis used in
       the match).

   Backreferences
       Closely associated with the matching variables $1, $2, ... are the backreferences "\g1",
       "\g2",...  Backreferences are simply matching variables that can be used inside a regexp.
       This is a really nice feature; what matches later in a regexp is made to depend on what
       matched earlier in the regexp.  Suppose we wanted to look for doubled words in a text,
       like "the the".  The following regexp finds all 3-letter doubles with a space in between:

           /\b(\w\w\w)\s\g1\b/;

       The grouping assigns a value to "\g1", so that the same 3-letter sequence is used for both
       parts.

       A similar task is to find words consisting of two identical parts:

           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       The regexp has a single grouping which considers 4-letter combinations, then 3-letter
       combinations, etc., and uses "\g1" to look for a repeat.  Although $1 and "\g1" represent
       the same thing, care should be taken to use matched variables $1, $2,... only outside a
       regexp and backreferences "\g1", "\g2",... only inside a regexp; not doing so may lead to
       surprising and unsatisfactory results.

   Relative backreferences
       Counting the opening parentheses to get the correct number for a backreference is error-
       prone as soon as there is more than one capturing group.  A more convenient technique
       became available with Perl 5.10: relative backreferences. To refer to the immediately
       preceding capture group one now may write "\g-1" or "\g{-1}", the next but last is
       available via "\g-2" or "\g{-2}", and so on.

       Another good reason in addition to readability and maintainability for using relative
       backreferences is illustrated by the following example, where a simple pattern for
       matching peculiar strings is used:

           $a99a = '([a-z])(\d)\g2\g1';   # matches a11a, g22g, x33x, etc.

       Now that we have this pattern stored as a handy string, we might feel tempted to use it as
       a part of some other pattern:

           $line = "code=e99e";
           if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
               print "$1 is valid\n";
           } else {
               print "bad line: '$line'\n";
           }

       But this doesn't match, at least not the way one might expect. Only after inserting the
       interpolated $a99a and looking at the resulting full text of the regexp is it obvious that
       the backreferences have backfired. The subexpression "(\w+)" has snatched number 1 and
       demoted the groups in $a99a by one rank. This can be avoided by using relative
       backreferences:

           $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

   Named backreferences
       Perl 5.10 also introduced named capture groups and named backreferences.  To attach a name
       to a capturing group, you write either "(?<name>...)" or "(?'name'...)".  The
       backreference may then be written as "\g{name}".  It is permissible to attach the same
       name to more than one group, but then only the leftmost one of the eponymous set can be
       referenced.  Outside of the pattern a named capture group is accessible through the "%+"
       hash.

       Assuming that we have to match calendar dates which may be given in one of the three
       formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write three suitable patterns where
       we use 'd', 'm' and 'y' respectively as the names of the groups capturing the pertaining
       components of a date. The matching operation combines the three patterns as alternatives:

           $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
           $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
           $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
           for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
               if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
                   print "day=$+{d} month=$+{m} year=$+{y}\n";
               }
           }

       If any of the alternatives matches, the hash "%+" is bound to contain the three key-value
       pairs.

   Alternative capture group numbering
       Yet another capturing group numbering technique (also as from Perl 5.10) deals with the
       problem of referring to groups within a set of alternatives.  Consider a pattern for
       matching a time of the day, civil or military style:

           if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
               # process hour and minute
           }

       Processing the results requires an additional if statement to determine whether $1 and $2
       or $3 and $4 contain the goodies. It would be easier if we could use group numbers 1 and 2
       in second alternative as well, and this is exactly what the parenthesized construct
       "(?|...)", set around an alternative achieves. Here is an extended version of the previous
       pattern:

         if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
             print "hour=$1 minute=$2 zone=$3\n";
         }

       Within the alternative numbering group, group numbers start at the same position for each
       alternative. After the group, numbering continues with one higher than the maximum reached
       across all the alternatives.

   Position information
       In addition to what was matched, Perl also provides the positions of what was matched as
       contents of the "@-" and "@+" arrays. "$-[0]" is the position of the start of the entire
       match and $+[0] is the position of the end. Similarly, "$-[n]" is the position of the
       start of the $n match and $+[n] is the position of the end. If $n is undefined, so are
       "$-[n]" and $+[n]. Then this code

           $x = "Mmm...donut, thought Homer";
           $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
           foreach $exp (1..$#-) {
               no strict 'refs';
               print "Match $exp: '$$exp' at position ($-[$exp],$+[$exp])\n";
           }

       prints

           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)

       Even if there are no groupings in a regexp, it is still possible to find out what exactly
       matched in a string.  If you use them, Perl will set "$`" to the part of the string before
       the match, will set $& to the part of the string that matched, and will set "$'" to the
       part of the string after the match.  An example:

           $x = "the cat caught the mouse";
           $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
           $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

       In the second match, "$`" equals '' because the regexp matched at the first character
       position in the string and stopped; it never saw the second "the".

       If your code is to run on Perl versions earlier than 5.20, it is worthwhile to note that
       using "$`" and "$'" slows down regexp matching quite a bit, while $& slows it down to a
       lesser extent, because if they are used in one regexp in a program, they are generated for
       all regexps in the program.  So if raw performance is a goal of your application, they
       should be avoided.  If you need to extract the corresponding substrings, use "@-" and "@+"
       instead:

           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )

       As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" variables may be
       used.  These are only set if the "/p" modifier is present.  Consequently they do not
       penalize the rest of the program.  In Perl 5.20, "${^PREMATCH}", "${^MATCH}" and
       "${^POSTMATCH}" are available whether the "/p" has been used or not (the modifier is
       ignored), and "$`", "$'" and $& do not cause any speed difference.

   Non-capturing groupings
       A group that is required to bundle a set of alternatives may or may not be useful as a
       capturing group.  If it isn't, it just creates a superfluous addition to the set of
       available capture group values, inside as well as outside the regexp.  Non-capturing
       groupings, denoted by "(?:regexp)", still allow the regexp to be treated as a single unit,
       but don't establish a capturing group at the same time.  Both capturing and non-capturing
       groupings are allowed to co-exist in the same regexp.  Because there is no extraction,
       non-capturing groupings are faster than capturing groupings.  Non-capturing groupings are
       also handy for choosing exactly which parts of a regexp are to be extracted to matching
       variables:

           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

           # match a number, get $1 = whole number, $2 = exponent
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

       Non-capturing groupings are also useful for removing nuisance elements gathered from a
       split operation where parentheses are required for some reason:

           $x = '12aba34ba5';
           @num = split /(a|b)+/, $x;    # @num = ('12','a','34','a','5')
           @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

       In Perl 5.22 and later, all groups within a regexp can be set to non-capturing by using
       the new "/n" flag:

           "hello" =~ /(hi|hello)/n; # $1 is not set!

       See "n" in perlre for more information.

   Matching repetitions
       The examples in the previous section display an annoying weakness.  We were only matching
       3-letter words, or chunks of words of 4 letters or less.  We'd like to be able to match
       words or, more generally, strings of any length, without writing out tedious alternatives
       like "\w\w\w\w|\w\w\w|\w\w|\w".

       This is exactly the problem the quantifier metacharacters '?', '*', '+', and "{}" were
       created for.  They allow us to delimit the number of repeats for a portion of a regexp we
       consider to be a match.  Quantifiers are put immediately after the character, character
       class, or grouping that we want to specify.  They have the following meanings:

       o   "a?" means: match 'a' 1 or 0 times

       o   "a*" means: match 'a' 0 or more times, i.e., any number of times

       o   "a+" means: match 'a' 1 or more times, i.e., at least once

       o   "a{n,m}" means: match at least "n" times, but not more than "m" times.

       o   "a{n,}" means: match at least "n" or more times

       o   "a{,n}" means: match at most "n" times, or fewer

       o   "a{n}" means: match exactly "n" times

       If you like, you can add blanks (tab or space characters) within the braces, but adjacent
       to them, and/or next to the comma (if any).

       Here are some examples:

           /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                            # any number of digits
           /(\w+)\s+\g1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /^\d{2,4}$/;  # make sure year is at least 2 but not more
                                  # than 4 digits
           $year =~ /^\d{ 2, 4 }$/;    # Same; for those who like wide open
                                       # spaces.
           $year =~ /^\d{2, 4}$/;      # Same.
           $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
           $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
                                       # However, this captures the last two
                                       # digits in $1 and the other does not.

           % simple_grep '^(\w+)\g1$' /usr/dict/words   # isn't this easier?
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       For all of these quantifiers, Perl will try to match as much of the string as possible,
       while still allowing the regexp to succeed.  Thus with "/a?.../", Perl will first try to
       match the regexp with the 'a' present; if that fails, Perl will try to match the regexp
       without the 'a' present.  For the quantifier '*', we get the following:

           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'

       Which is what we might expect, the match finds the only "cat" in the string and locks onto
       it.  Consider, however, this regexp:

           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 characters match)

       One might initially guess that Perl would find the "at" in "cat" and stop there, but that
       wouldn't give the longest possible string to the first quantifier ".*".  Instead, the
       first quantifier ".*" grabs as much of the string as possible while still having the
       regexp match.  In this example, that means having the "at" sequence with the final "at" in
       the string.  The other important principle illustrated here is that, when there are two or
       more elements in a regexp, the leftmost quantifier, if there is one, gets to grab as much
       of the string as possible, leaving the rest of the regexp to fight over scraps.  Thus in
       our example, the first quantifier ".*" grabs most of the string, while the second
       quantifier ".*" gets the empty string.   Quantifiers that grab as much of the string as
       possible are called maximal match or greedy quantifiers.

       When a regexp can match a string in several different ways, we can use the principles
       above to predict which way the regexp will match:

       o   Principle 0: Taken as a whole, any regexp will be matched at the earliest possible
           position in the string.

       o   Principle 1: In an alternation "a|b|c...", the leftmost alternative that allows a
           match for the whole regexp will be the one used.

       o   Principle 2: The maximal matching quantifiers '?', '*', '+' and "{n,m}" will in
           general match as much of the string as possible while still allowing the whole regexp
           to match.

       o   Principle 3: If there are two or more elements in a regexp, the leftmost greedy
           quantifier, if any, will match as much of the string as possible while still allowing
           the whole regexp to match.  The next leftmost greedy quantifier, if any, will try to
           match as much of the string remaining available to it as possible, while still
           allowing the whole regexp to match.  And so on, until all the regexp elements are
           satisfied.

       As we have seen above, Principle 0 overrides the others. The regexp will be matched as
       early as possible, with the other principles determining how the regexp matches at that
       earliest character position.

       Here is an example of these principles in action:

           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'

       This regexp matches at the earliest string position, 'T'.  One might think that 'e', being
       leftmost in the alternation, would be matched, but 'r' produces the longest string in the
       first quantifier.

           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'

       Here, The earliest possible match is at the first 'm' in "programming". "m{1,2}" is the
       first quantifier, so it gets to match a maximal "mm".

           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'

       Here, the regexp matches at the start of the string. The first quantifier ".*" grabs as
       much as possible, leaving just a single 'm' for the second quantifier "m{1,2}".

           $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                       # $1 = 'a'
                                       # $2 = 'mm'
                                       # $3 = 'ing republic of Perl'

       Here, ".?" eats its maximal one character at the earliest possible position in the string,
       'a' in "programming", leaving "m{1,2}" the opportunity to match both 'm''s. Finally,

           "aXXXb" =~ /(X*)/; # matches with $1 = ''

       because it can match zero copies of 'X' at the beginning of the string.  If you definitely
       want to match at least one 'X', use "X+", not "X*".

       Sometimes greed is not good.  At times, we would like quantifiers to match a minimal piece
       of string, rather than a maximal piece.  For this purpose, Larry Wall created the minimal
       match or non-greedy quantifiers "??", "*?", "+?", and "{}?".  These are the usual
       quantifiers with a '?' appended to them.  They have the following meanings:

       o   "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.

       o   "a*?" means: match 'a' 0 or more times, i.e., any number of times, but as few times as
           possible

       o   "a+?" means: match 'a' 1 or more times, i.e., at least once, but as few times as
           possible

       o   "a{n,m}?" means: match at least "n" times, not more than "m" times, as few times as
           possible

       o   "a{n,}?" means: match at least "n" times, but as few times as possible

       o   "a{,n}?" means: match at most "n" times, but as few times as possible

       o   "a{n}?" means: match exactly "n" times.  Because we match exactly "n" times, "a{n}?"
           is equivalent to "a{n}" and is just there for notational consistency.

       Let's look at the example above, but with minimal quantifiers:

           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'

       The minimal string that will allow both the start of the string '^' and the alternation to
       match is "Th", with the alternation "e|r" matching 'e'.  The second quantifier ".*" is
       free to gobble up the rest of the string.

           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'

       The first string position that this regexp can match is at the first 'm' in "programming".
       At this position, the minimal "m{1,2}?"  matches just one 'm'.  Although the second
       quantifier ".*?" would prefer to match no characters, it is constrained by the end-of-
       string anchor '$' to match the rest of the string.

           $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                         # $1 = 'The progra'
                                         # $2 = 'm'
                                         # $3 = 'ming republic of Perl'

       In this regexp, you might expect the first minimal quantifier ".*?"  to match the empty
       string, because it is not constrained by a '^' anchor to match the beginning of the word.
       Principle 0 applies here, however.  Because it is possible for the whole regexp to match
       at the start of the string, it will match at the start of the string.  Thus the first
       quantifier has to match everything up to the first 'm'.  The second minimal quantifier
       matches just one 'm' and the third quantifier matches the rest of the string.

           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'
                                        # $2 = 'mm'
                                        # $3 = 'ing republic of Perl'

       Just as in the previous regexp, the first quantifier ".??" can match earliest at position
       'a', so it does.  The second quantifier is greedy, so it matches "mm", and the third
       matches the rest of the string.

       We can modify principle 3 above to take into account non-greedy quantifiers:

       o   Principle 3: If there are two or more elements in a regexp, the leftmost greedy (non-
           greedy) quantifier, if any, will match as much (little) of the string as possible
           while still allowing the whole regexp to match.  The next leftmost greedy (non-greedy)
           quantifier, if any, will try to match as much (little) of the string remaining
           available to it as possible, while still allowing the whole regexp to match.  And so
           on, until all the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to backtracking.  Here is a step-
       by-step analysis of the example

           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       0.  Start with the first letter in the string 't'.

       1.  The first quantifier '.*' starts out by matching the whole string ""the cat in the
       hat"".

       2.  'a' in the regexp element 'at' doesn't match the end of the string.  Backtrack one
       character.

       3.  'a' in the regexp element 'at' still doesn't match the last letter of the string 't',
       so backtrack one more character.

       4.  Now we can match the 'a' and the 't'.

       5.  Move on to the third element '.*'.  Since we are at the end of the string and '.*' can
       match 0 times, assign it the empty string.

       6.  We are done!

       Most of the time, all this moving forward and backtracking happens quickly and searching
       is fast. There are some pathological regexps, however, whose execution time exponentially
       grows with the size of the string.  A typical structure that blows up in your face is of
       the form

           /(a|b+)*/;

       The problem is the nested indeterminate quantifiers.  There are many different ways of
       partitioning a string of length n between the '+' and '*': one repetition with "b+" of
       length n, two repetitions with the first "b+" length k and the second with length n-k, m
       repetitions whose bits add up to length n, etc.  In fact there are an exponential number
       of ways to partition a string as a function of its length.  A regexp may get lucky and
       match early in the process, but if there is no match, Perl will try every possibility
       before giving up.  So be careful with nested '*''s, "{n,m}"'s, and '+''s.  The book
       Mastering Regular Expressions by Jeffrey Friedl gives a wonderful discussion of this and
       other efficiency issues.

   Possessive quantifiers
       Backtracking during the relentless search for a match may be a waste of time, particularly
       when the match is bound to fail.  Consider the simple pattern

           /^\w+\s+\w+$/; # a word, spaces, a word

       Whenever this is applied to a string which doesn't quite meet the pattern's expectations
       such as "abc" or "abcdef", the regexp engine will backtrack, approximately once for each
       character in the string.  But we know that there is no way around taking all of the
       initial word characters to match the first repetition, that all spaces must be eaten by
       the middle part, and the same goes for the second word.

       With the introduction of the possessive quantifiers in Perl 5.10, we have a way of
       instructing the regexp engine not to backtrack, with the usual quantifiers with a '+'
       appended to them.  This makes them greedy as well as stingy; once they succeed they won't
       give anything back to permit another solution. They have the following meanings:

       o   "a{n,m}+" means: match at least "n" times, not more than "m" times, as many times as
           possible, and don't give anything up. "a?+" is short for "a{0,1}+"

       o   "a{n,}+" means: match at least "n" times, but as many times as possible, and don't
           give anything up. "a++" is short for "a{1,}+".

       o   "a{,n}+" means: match as many times as possible up to at most "n" times, and don't
           give anything up. "a*+" is short for "a{0,}+".

       o   "a{n}+" means: match exactly "n" times.  It is just there for notational consistency.

       These possessive quantifiers represent a special case of a more general concept, the
       independent subexpression, see below.

       As an example where a possessive quantifier is suitable we consider matching a quoted
       string, as it appears in several programming languages.  The backslash is used as an
       escape character that indicates that the next character is to be taken literally, as
       another character for the string.  Therefore, after the opening quote, we expect a
       (possibly empty) sequence of alternatives: either some character except an unescaped quote
       or backslash or an escaped character.

           /"(?:[^"\\]++|\\.)*+"/;

   Building a regexp
       At this point, we have all the basic regexp concepts covered, so let's give a more
       involved example of a regular expression.  We will build a regexp that matches numbers.

       The first task in building a regexp is to decide what we want to match and what we want to
       exclude.  In our case, we want to match both integers and floating point numbers and we
       want to reject any string that isn't a number.

       The next task is to break the problem down into smaller problems that are easily converted
       into a regexp.

       The simplest case is integers.  These consist of a sequence of digits, with an optional
       sign in front.  The digits we can represent with "\d+" and the sign can be matched with
       "[+-]".  Thus the integer regexp is

           /[+-]?\d+/;  # matches integers

       A floating point number potentially has a sign, an integral part, a decimal point, a
       fractional part, and an exponent.  One or more of these parts is optional, so we need to
       check out the different possibilities.  Floating point numbers which are in proper form
       include 123., 0.345, .34, -1e6, and 25.4E-72.  As with integers, the sign out front is
       completely optional and can be matched by "[+-]?".  We can see that if there is no
       exponent, floating point numbers must have a decimal point, otherwise they are integers.
       We might be tempted to model these with "\d*\.\d*", but this would also match just a
       single decimal point, which is not a number.  So the three cases of floating point number
       without exponent are

          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-way alternation:

          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.  If '\d+\.' were
       first, the regexp would happily match that and ignore the fractional part of the number.

       Now consider floating point numbers with exponents.  The key observation here is that both
       integers and numbers with decimal points are allowed in front of an exponent.  Then
       exponents, like the overall sign, are independent of whether we are matching numbers with
       or without decimal points, and can be "decoupled" from the mantissa.  The overall form of
       the regexp now becomes clear:

           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       The exponent is an 'e' or 'E', followed by an integer.  So the exponent regexp is

          /[eE][+-]?\d+/;  # exponent

       Putting all the parts together, we get a regexp that matches numbers:

          /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

       Long regexps like this may impress your friends, but can be hard to decipher.  In complex
       situations like this, the "/x" modifier for a match is invaluable.  It allows one to put
       nearly arbitrary whitespace and comments into a regexp without affecting their meaning.
       Using it, we can rewrite our "extended" regexp in the more pleasing form

          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       If whitespace is mostly irrelevant, how does one include space characters in an extended
       regexp? The answer is to backslash it '\' or put it in a character class "[]".  The same
       thing goes for pound signs: use "\#" or "[#]".  For instance, Perl allows a space between
       the sign and the mantissa or integer, and we could add this to our regexp as follows:

          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       In this form, it is easier to see a way to simplify the alternation.  Alternatives 1, 2,
       and 4 all start with "\d+", so it could be factored out:

          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       Starting in Perl v5.26, specifying "/xx" changes the square-bracketed portions of a
       pattern to ignore tabs and space characters unless they are escaped by preceding them with
       a backslash.  So, we could write

          /^
             [ + - ]?\ *   # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [ e E ] [ + - ]? \d+ )?  # finally, optionally match an exponent
          $/xx;

       This doesn't really improve the legibility of this example, but it's available in case you
       want it.  Squashing the pattern down to the compact form, we have

           /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

       This is our final regexp.  To recap, we built a regexp by

       o   specifying the task in detail,

       o   breaking down the problem into smaller parts,

       o   translating the small parts into regexps,

       o   combining the regexps,

       o   and optimizing the final combined regexp.

       These are also the typical steps involved in writing a computer program.  This makes
       perfect sense, because regular expressions are essentially programs written in a little
       computer language that specifies patterns.

   Using regular expressions in Perl
       The last topic of Part 1 briefly covers how regexps are used in Perl programs.  Where do
       they fit into Perl syntax?

       We have already introduced the matching operator in its default "/regexp/" and arbitrary
       delimiter "m!regexp!" forms.  We have used the binding operator "=~" and its negation "!~"
       to test for string matches.  Associated with the matching operator, we have discussed the
       single line "/s", multi-line "/m", case-insensitive "/i" and extended "/x" modifiers.
       There are a few more things you might want to know about matching operators.

       Prohibiting substitution

       If you change $pattern after the first substitution happens, Perl will ignore it.  If you
       don't want any substitutions at all, use the special delimiter "m''":

           @pattern = ('Seuss');
           while (<>) {
               print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
           }

       Similar to strings, "m''" acts like apostrophes on a regexp; all other 'm' delimiters act
       like quotes.  If the regexp evaluates to the empty string, the regexp in the last
       successful match is used instead.  So we have

           "dog" =~ /d/;  # 'd' matches
           "dogbert" =~ //;  # this matches the 'd' regexp used before

       Global matching

       The final two modifiers we will discuss here, "/g" and "/c", concern multiple matches.
       The modifier "/g" stands for global matching and allows the matching operator to match
       within a string as many times as possible.  In scalar context, successive invocations
       against a string will have "/g" jump from match to match, keeping track of position in the
       string as it goes along.  You can get or set the position with the "pos()" function.

       The use of "/g" is shown in the following example.  Suppose we have a string that consists
       of words separated by spaces.  If we know how many words there are in advance, we could
       extract the words using groupings:

           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'
                                                  # $3 = 'house'

       But what if we had an indeterminate number of words? This is the sort of task "/g" was
       made for.  To extract all words, form the simple regexp "(\w+)" and loop over all matches
       with "/(\w+)/g":

           while ($x =~ /(\w+)/g) {
               print "Word is $1, ends at position ", pos $x, "\n";
           }

       prints

           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13

       A failed match or changing the target string resets the position.  If you don't want the
       position reset after failure to match, add the "/c", as in "/regexp/gc".  The current
       position in the string is associated with the string, not the regexp.  This means that
       different strings have different positions and their respective positions can be set or
       read independently.

       In list context, "/g" returns a list of matched groupings, or if there are no groupings, a
       list of matches to the whole regexp.  So if we wanted just the words, we could use

           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $words[0] = 'cat'
                                       # $words[1] = 'dog'
                                       # $words[2] = 'house'

       Closely associated with the "/g" modifier is the "\G" anchor.  The "\G" anchor matches at
       the point where the previous "/g" match left off.  "\G" allows us to easily do context-
       sensitive matching:

           $metric = 1;  # use metric units
           ...
           $x = <FILE>;  # read in measurement
           $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
           $weight = $1;
           if ($metric) { # error checking
               print "Units error!" unless $x =~ /\Gkg\./g;
           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

       The combination of "/g" and "\G" allows us to process the string a bit at a time and use
       arbitrary Perl logic to decide what to do next.  Currently, the "\G" anchor is only fully
       supported when used to anchor to the start of the pattern.

       "\G" is also invaluable in processing fixed-length records with regexps.  Suppose we have
       a snippet of coding region DNA, encoded as base pair letters "ATCGTTGAAT..." and we want
       to find all the stop codons "TGA".  In a coding region, codons are 3-letter sequences, so
       we can think of the DNA snippet as a sequence of 3-letter records.  The naive regexp

           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;

       doesn't work; it may match a "TGA", but there is no guarantee that the match is aligned
       with codon boundaries, e.g., the substring "GTTGAA" gives a match.  A better solution is

           while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       which prints

           Got a TGA stop codon at position 18
           Got a TGA stop codon at position 23

       Position 18 is good, but position 23 is bogus.  What happened?

       The answer is that our regexp works well until we get past the last real match.  Then the
       regexp will fail to match a synchronized "TGA" and start stepping ahead one character
       position at a time, not what we want.  The solution is to use "\G" to anchor the match to
       the codon alignment:

           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       This prints

           Got a TGA stop codon at position 18

       which is the correct answer.  This example illustrates that it is important not only to
       match what is desired, but to reject what is not desired.

       (There are other regexp modifiers that are available, such as "/o", but their specialized
       uses are beyond the scope of this introduction.  )

       Search and replace

       Regular expressions also play a big role in search and replace operations in Perl.  Search
       and replace is accomplished with the "s///" operator.  The general form is
       "s/regexp/replacement/modifiers", with everything we know about regexps and modifiers
       applying in this case as well.  The replacement is a Perl double-quoted string that
       replaces in the string whatever is matched with the "regexp".  The operator "=~" is also
       used here to associate a string with "s///".  If matching against $_, the "$_=~" can be
       dropped.  If there is a match, "s///" returns the number of substitutions made; otherwise
       it returns false.  Here are a few examples:

           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"

       In the last example, the whole string was matched, but only the part inside the single
       quotes was grouped.  With the "s///" operator, the matched variables $1, $2, etc. are
       immediately available for use in the replacement expression, so we use $1 to replace the
       quoted string with just what was quoted.  With the global modifier, "s///g" will search
       and replace all occurrences of the regexp in the string:

           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
                              # $x contains "I batted four for four"

       If you prefer "regex" over "regexp" in this tutorial, you could use the following program
       to replace it:

           % cat > simple_replace
           #!/usr/bin/perl
           $regexp = shift;
           $replacement = shift;
           while (<>) {
               s/$regexp/$replacement/g;
               print;
           }
           ^D

           % simple_replace regexp regex perlretut.pod

       In "simple_replace" we used the "s///g" modifier to replace all occurrences of the regexp
       on each line.  (Even though the regular expression appears in a loop, Perl is smart enough
       to compile it only once.)  As with "simple_grep", both the "print" and the
       "s/$regexp/$replacement/g" use $_ implicitly.

       If you don't want "s///" to change your original variable you can use the non-destructive
       substitute modifier, "s///r".  This changes the behavior so that "s///r" returns the final
       substituted string (instead of the number of substitutions):

           $x = "I like dogs.";
           $y = $x =~ s/dogs/cats/r;
           print "$x $y\n";

       That example will print "I like dogs. I like cats". Notice the original $x variable has
       not been affected. The overall result of the substitution is instead stored in $y. If the
       substitution doesn't affect anything then the original string is returned:

           $x = "I like dogs.";
           $y = $x =~ s/elephants/cougars/r;
           print "$x $y\n"; # prints "I like dogs. I like dogs."

       One other interesting thing that the "s///r" flag allows is chaining substitutions:

           $x = "Cats are great.";
           print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
               s/Frogs/Hedgehogs/r, "\n";
           # prints "Hedgehogs are great."

       A modifier available specifically to search and replace is the "s///e" evaluation
       modifier.  "s///e" treats the replacement text as Perl code, rather than a double-quoted
       string.  The value that the code returns is substituted for the matched substring.
       "s///e" is useful if you need to do a bit of computation in the process of replacing text.
       This example counts character frequencies in a line:

           $x = "Bill the cat";
           $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
           print "frequency of '$_' is $chars{$_}\n"
               foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

       This prints

           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1

       As with the match "m//" operator, "s///" can use other delimiters, such as "s!!!" and
       "s{}{}", and even "s{}//".  If single quotes are used "s'''", then the regexp and
       replacement are treated as single-quoted strings and there are no variable substitutions.
       "s///" in list context returns the same thing as in scalar context, i.e., the number of
       matches.

       The split function

       The "split()" function is another place where a regexp is used.  "split /regexp/, string,
       limit" separates the "string" operand into a list of substrings and returns that list.
       The regexp must be designed to match whatever constitutes the separators for the desired
       substrings.  The "limit", if present, constrains splitting into no more than "limit"
       number of strings.  For example, to split a string into words, use

           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'

       If the empty regexp "//" is used, the regexp always matches and the string is split into
       individual characters.  If the regexp has groupings, then the resulting list contains the
       matched substrings from the groupings as well.  For instance,

           $x = "/usr/bin/perl";
           @dirs = split m!/!, $x;  # $dirs[0] = ''
                                    # $dirs[1] = 'usr'
                                    # $dirs[2] = 'bin'
                                    # $dirs[3] = 'perl'
           @parts = split m!(/)!, $x;  # $parts[0] = ''
                                       # $parts[1] = '/'
                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'
                                       # $parts[4] = 'bin'
                                       # $parts[5] = '/'
                                       # $parts[6] = 'perl'

       Since the first character of $x matched the regexp, "split" prepended an empty initial
       element to the list.

       If you have read this far, congratulations! You now have all the basic tools needed to use
       regular expressions to solve a wide range of text processing problems.  If this is your
       first time through the tutorial, why not stop here and play around with regexps a
       while....  Part2 concerns the more esoteric aspects of regular expressions and those
       concepts certainly aren't needed right at the start.

Part 2: Power tools
       OK, you know the basics of regexps and you want to know more.  If matching regular
       expressions is analogous to a walk in the woods, then the tools discussed in Part 1 are
       analogous to topo maps and a compass, basic tools we use all the time.  Most of the tools
       in part 2 are analogous to flare guns and satellite phones.  They aren't used too often on
       a hike, but when we are stuck, they can be invaluable.

       What follows are the more advanced, less used, or sometimes esoteric capabilities of Perl
       regexps.  In Part 2, we will assume you are comfortable with the basics and concentrate on
       the advanced features.

   More on characters, strings, and character classes
       There are a number of escape sequences and character classes that we haven't covered yet.

       There are several escape sequences that convert characters or strings between upper and
       lower case, and they are also available within patterns.  "\l" and "\u" convert the next
       character to lower or upper case, respectively:

           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

       A "\L" or "\U" indicates a lasting conversion of case, until terminated by "\E" or thrown
       over by another "\U" or "\L":

           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360";
           $x =~ /\Ukeypunch/;  # matches punch card string

       If there is no "\E", case is converted until the end of the string. The regexps
       "\L\u$word" or "\u\L$word" convert the first character of $word to uppercase and the rest
       of the characters to lowercase.

       Control characters can be escaped with "\c", so that a control-Z character would be
       matched with "\cZ".  The escape sequence "\Q"..."\E" quotes, or protects most non-
       alphabetic characters.   For instance,

           $x = "\QThat !^*&%~& cat!";
           $x =~ /\Q!^*&%~&\E/;  # check for rough language

       It does not protect '$' or '@', so that variables can still be substituted.

       "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-quotish syntax, and not
       part of regexp syntax proper.  They will work if they appear in a regular expression
       embedded directly in a program, but not when contained in a string that is interpolated in
       a pattern.

       Perl regexps can handle more than just the standard ASCII character set.  Perl supports
       Unicode, a standard for representing the alphabets from virtually all of the world's
       written languages, and a host of symbols.  Perl's text strings are Unicode strings, so
       they can contain characters with a value (codepoint or character number) higher than 255.

       What does this mean for regexps? Well, regexp users don't need to know much about Perl's
       internal representation of strings.  But they do need to know 1) how to represent Unicode
       characters in a regexp and 2) that a matching operation will treat the string to be
       searched as a sequence of characters, not bytes.  The answer to 1) is that Unicode
       characters greater than "chr(255)" are represented using the "\x{hex}" notation, because
       "\x"XY (without curly braces and XY are two hex digits) doesn't go further than 255.
       (Starting in Perl 5.14, if you're an octal fan, you can also use "\o{oct}".)

           /\x{263a}/;   # match a Unicode smiley face :)
           /\x{ 263a }/; # Same

       NOTE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to use any Unicode
       features.  This is no longer the case: for almost all Unicode processing, the explicit
       "utf8" pragma is not needed.  (The only case where it matters is if your Perl script is in
       Unicode and encoded in UTF-8, then an explicit "use utf8" is needed.)

       Figuring out the hexadecimal sequence of a Unicode character you want or deciphering
       someone else's hexadecimal Unicode regexp is about as much fun as programming in machine
       code.  So another way to specify Unicode characters is to use the named character escape
       sequence "\N{name}".  name is a name for the Unicode character, as specified in the
       Unicode standard.  For instance, if we wanted to represent or match the astrological sign
       for the planet Mercury, we could use

           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches
           $x =~ /\N{ MERCURY }/; # Also matches

       One can also use "short" names:

           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
           print "\N{greek:Sigma} is an upper-case sigma.\n";

       You can also restrict names to a certain alphabet by specifying the charnames pragma:

           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";

       An index of character names is available on-line from the Unicode Consortium,
       <https://www.unicode.org/charts/charindex.html>; explanatory material with links to other
       resources at <https://www.unicode.org/standard/where>.

       Starting in Perl v5.32, an alternative to "\N{...}" for full names is available, and that
       is to say

        /\p{Name=greek small letter sigma}/

       The casing of the character name is irrelevant when used in "\p{}", as are most spaces,
       underscores and hyphens.  (A few outlier characters cause problems with ignoring all of
       them always.  The details (which you can look up when you get more proficient, and if ever
       needed) are in <https://www.unicode.org/reports/tr44/tr44-24.html#UAX44-LM2>).

       The answer to requirement 2) is that a regexp (mostly) uses Unicode characters.  The
       "mostly" is for messy backward compatibility reasons, but starting in Perl 5.14, any
       regexp compiled in the scope of a "use feature 'unicode_strings'" (which is automatically
       turned on within the scope of a "use 5.012" or higher) will turn that "mostly" into
       "always".  If you want to handle Unicode properly, you should ensure that
       'unicode_strings' is turned on.  Internally, this is encoded to bytes using either UTF-8
       or a native 8 bit encoding, depending on the history of the string, but conceptually it is
       a sequence of characters, not bytes. See perlunitut for a tutorial about that.

       Let us now discuss Unicode character classes, most usually called "character properties".
       These are represented by the "\p{name}" escape sequence.  The negation of this is
       "\P{name}".  For example, to match lower and uppercase characters,

           $x = "BOB";
           $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
           $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
           $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       (The ""Is"" is optional.)

       There are many, many Unicode character properties.  For the full list see perluniprops.
       Most of them have synonyms with shorter names, also listed there.  Some synonyms are a
       single character.  For these, you can drop the braces.  For instance, "\pM" is the same
       thing as "\p{Mark}", meaning things like accent marks.

       The Unicode "\p{Script}" and "\p{Script_Extensions}" properties are used to categorize
       every Unicode character into the language script it is written in.  For example, English,
       French, and a bunch of other European languages are written in the Latin script.  But
       there is also the Greek script, the Thai script, the Katakana script, etc.  ("Script" is
       an older, less advanced, form of "Script_Extensions", retained only for backwards
       compatibility.)  You can test whether a character is in a particular script  with, for
       example "\p{Latin}", "\p{Greek}", or "\p{Katakana}".  To test if it isn't in the Balinese
       script, you would use "\P{Balinese}".  (These all use "Script_Extensions" under the hood,
       as that gives better results.)

       What we have described so far is the single form of the "\p{...}" character classes.
       There is also a compound form which you may run into.  These look like "\p{name=value}" or
       "\p{name:value}" (the equals sign and colon can be used interchangeably).  These are more
       general than the single form, and in fact most of the single forms are just Perl-defined
       shortcuts for common compound forms.  For example, the script examples in the previous
       paragraph could be written equivalently as "\p{Script_Extensions=Latin}",
       "\p{Script_Extensions:Greek}", "\p{script_extensions=katakana}", and
       "\P{script_extensions=balinese}" (case is irrelevant between the "{}" braces).  You may
       never have to use the compound forms, but sometimes it is necessary, and their use can
       make your code easier to understand.

       "\X" is an abbreviation for a character class that comprises a Unicode extended grapheme
       cluster.  This represents a "logical character": what appears to be a single character,
       but may be represented internally by more than one.  As an example, using the Unicode full
       names, e.g., "A+COMBININGRING" is a grapheme cluster with base character "A" and combining
       character "COMBININGRING, which translates in Danish to "A" with the circle atop it, as in
       the word Angstrom.

       For the full and latest information about Unicode see the latest Unicode standard, or the
       Unicode Consortium's website <https://www.unicode.org>

       As if all those classes weren't enough, Perl also defines POSIX-style character classes.
       These have the form "[:name:]", with name the name of the POSIX class.  The POSIX classes
       are "alpha", "alnum", "ascii", "cntrl", "digit", "graph", "lower", "print", "punct",
       "space", "upper", and "xdigit", and two extensions, "word" (a Perl extension to match
       "\w"), and "blank" (a GNU extension).  The "/a" modifier restricts these to matching just
       in the ASCII range; otherwise they can match the same as their corresponding Perl Unicode
       classes: "[:upper:]" is the same as "\p{IsUpper}", etc.  (There are some exceptions and
       gotchas with this; see perlrecharclass for a full discussion.) The "[:digit:]",
       "[:word:]", and "[:space:]" correspond to the familiar "\d", "\w", and "\s" character
       classes.  To negate a POSIX class, put a '^' in front of the name, so that, e.g.,
       "[:^digit:]" corresponds to "\D" and, under Unicode, "\P{IsDigit}".  The Unicode and POSIX
       character classes can be used just like "\d", with the exception that POSIX character
       classes can only be used inside of a character class:

           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit

       Whew! That is all the rest of the characters and character classes.

   Compiling and saving regular expressions
       In Part 1 we mentioned that Perl compiles a regexp into a compact sequence of opcodes.
       Thus, a compiled regexp is a data structure that can be stored once and used again and
       again.  The regexp quote "qr//" does exactly that: "qr/string/" compiles the "string" as a
       regexp and transforms the result into a form that can be assigned to a variable:

           $reg = qr/foo+bar?/;  # reg contains a compiled regexp

       Then $reg can be used as a regexp:

           $x = "fooooba";
           $x =~ $reg;     # matches, just like /foo+bar?/
           $x =~ /$reg/;   # same thing, alternate form

       $reg can also be interpolated into a larger regexp:

           $x =~ /(abc)?$reg/;  # still matches

       As with the matching operator, the regexp quote can use different delimiters, e.g.,
       "qr!!", "qr{}" or "qr~~".  Apostrophes as delimiters ("qr''") inhibit any interpolation.

       Pre-compiled regexps are useful for creating dynamic matches that don't need to be
       recompiled each time they are encountered.  Using pre-compiled regexps, we write a
       "grep_step" program which greps for a sequence of patterns, advancing to the next pattern
       as soon as one has been satisfied.

           % cat > grep_step
           #!/usr/bin/perl
           # grep_step - match <number> regexps, one after the other
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               if ($line =~ /$compiled[0]/) {
                   print $line;
                   shift @compiled;
                   last unless @compiled;
               }
           }
           ^D

           % grep_step 3 shift print last grep_step
           $number = shift;
                   print $line;
                   last unless @compiled;

       Storing pre-compiled regexps in an array @compiled allows us to simply loop through the
       regexps without any recompilation, thus gaining flexibility without sacrificing speed.

   Composing regular expressions at runtime
       Backtracking is more efficient than repeated tries with different regular expressions.  If
       there are several regular expressions and a match with any of them is acceptable, then it
       is possible to combine them into a set of alternatives.  If the individual expressions are
       input data, this can be done by programming a join operation.  We'll exploit this idea in
       an improved version of the "simple_grep" program: a program that matches multiple
       patterns:

           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           $pattern = join '|', @regexp;

           while ($line = <>) {
               print $line if $line =~ /$pattern/;
           }
           ^D

           % multi_grep 2 shift for multi_grep
           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);

       Sometimes it is advantageous to construct a pattern from the input that is to be analyzed
       and use the permissible values on the left hand side of the matching operations.  As an
       example for this somewhat paradoxical situation, let's assume that our input contains a
       command verb which should match one out of a set of available command verbs, with the
       additional twist that commands may be abbreviated as long as the given string is unique.
       The program below demonstrates the basic algorithm.

           % cat > keymatch
           #!/usr/bin/perl
           $kwds = 'copy compare list print';
           while( $cmd = <> ){
               $cmd =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
               if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
                   print "command: '@matches'\n";
               } elsif( @matches == 0 ){
                   print "no such command: '$cmd'\n";
               } else {
                   print "not unique: '$cmd' (could be one of: @matches)\n";
               }
           }
           ^D

           % keymatch
           li
           command: 'list'
           co
           not unique: 'co' (could be one of: copy compare)
           printer
           no such command: 'printer'

       Rather than trying to match the input against the keywords, we match the combined set of
       keywords against the input.  The pattern matching operation "$kwds=~/\b($cmd\w*)/g" does
       several things at the same time. It makes sure that the given command begins where a
       keyword begins ("\b"). It tolerates abbreviations due to the added "\w*". It tells us the
       number of matches ("scalar @matches") and all the keywords that were actually matched.
       You could hardly ask for more.

   Embedding comments and modifiers in a regular expression
       Starting with this section, we will be discussing Perl's set of extended patterns.  These
       are extensions to the traditional regular expression syntax that provide powerful new
       tools for pattern matching.  We have already seen extensions in the form of the minimal
       matching constructs "??", "*?", "+?", "{n,m}?", "{n,}?", and "{,n}?".  Most of the
       extensions below have the form "(?char...)", where the "char" is a character that
       determines the type of extension.

       The first extension is an embedded comment "(?#text)".  This embeds a comment into the
       regular expression without affecting its meaning.  The comment should not have any closing
       parentheses in the text.  An example is

           /(?# Match an integer:)[+-]?\d+/;

       This style of commenting has been largely superseded by the raw, freeform commenting that
       is allowed with the "/x" modifier.

       Most modifiers, such as "/i", "/m", "/s" and "/x" (or any combination thereof) can also be
       embedded in a regexp using "(?i)", "(?m)", "(?s)", and "(?x)".  For instance,

           /(?i)yes/;  # match 'yes' case insensitively
           /yes/i;     # same thing
           /(?x)(          # freeform version of an integer regexp
                    [+-]?  # match an optional sign
                    \d+    # match a sequence of digits
                )
           /x;

       Embedded modifiers can have two important advantages over the usual modifiers.  Embedded
       modifiers allow a custom set of modifiers for each regexp pattern.  This is great for
       matching an array of regexps that must have different modifiers:

           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }

       The second advantage is that embedded modifiers (except "/p", which modifies the entire
       regexp) only affect the regexp inside the group the embedded modifier is contained in.  So
       grouping can be used to localize the modifier's effects:

           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

       Embedded modifiers can also turn off any modifiers already present by using, e.g.,
       "(?-i)".  Modifiers can also be combined into a single expression, e.g., "(?s-i)" turns on
       single line mode and turns off case insensitivity.

       Embedded modifiers may also be added to a non-capturing grouping.  "(?i-m:regexp)" is a
       non-capturing grouping that matches "regexp" case insensitively and turns off multi-line
       mode.

   Looking ahead and looking behind
       This section concerns the lookahead and lookbehind assertions.  First, a little
       background.

       In Perl regular expressions, most regexp elements "eat up" a certain amount of string when
       they match.  For instance, the regexp element "[abc]" eats up one character of the string
       when it matches, in the sense that Perl moves to the next character position in the string
       after the match.  There are some elements, however, that don't eat up characters (advance
       the character position) if they match.  The examples we have seen so far are the anchors.
       The anchor '^' matches the beginning of the line, but doesn't eat any characters.
       Similarly, the word boundary anchor "\b" matches wherever a character matching "\w" is
       next to a character that doesn't, but it doesn't eat up any characters itself.  Anchors
       are examples of zero-width assertions: zero-width, because they consume no characters, and
       assertions, because they test some property of the string.  In the context of our walk in
       the woods analogy to regexp matching, most regexp elements move us along a trail, but
       anchors have us stop a moment and check our surroundings.  If the local environment checks
       out, we can proceed forward.  But if the local environment doesn't satisfy us, we must
       backtrack.

       Checking the environment entails either looking ahead on the trail, looking behind, or
       both.  '^' looks behind, to see that there are no characters before.  '$' looks ahead, to
       see that there are no characters after.  "\b" looks both ahead and behind, to see if the
       characters on either side differ in their "word-ness".

       The lookahead and lookbehind assertions are generalizations of the anchor concept.
       Lookahead and lookbehind are zero-width assertions that let us specify which characters we
       want to test for.  The lookahead assertion is denoted by "(?=regexp)" or (starting in
       5.32, experimentally in 5.28) "(*pla:regexp)" or "(*positive_lookahead:regexp)"; and the
       lookbehind assertion is denoted by "(?<=fixed-regexp)" or (starting in 5.32,
       experimentally in 5.28) "(*plb:fixed-regexp)" or "(*positive_lookbehind:fixed-regexp)".
       Some examples are

           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(*pla:\s)/;   # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x

       Note that the parentheses in these are non-capturing, since these are zero-width
       assertions.  Thus in the second regexp, the substrings captured are those of the whole
       regexp itself.  Lookahead can match arbitrary regexps, but lookbehind prior to 5.30
       "(?<=fixed-regexp)" only works for regexps of fixed width, i.e., a fixed number of
       characters long.  Thus "(?<=(ab|bc))" is fine, but "(?<=(ab)*)" prior to 5.30 is not.

       The negated versions of the lookahead and lookbehind assertions are denoted by
       "(?!regexp)" and "(?<!fixed-regexp)" respectively.  Or, starting in 5.32 (experimentally
       in 5.28), "(*nla:regexp)", "(*negative_lookahead:regexp)", "(*nlb:regexp)", or
       "(*negative_lookbehind:regexp)".  They evaluate true if the regexps do not match:

           $x = "foobar";
           $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
           $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
           $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

       Here is an example where a string containing blank-separated words, numbers and single
       dashes is to be split into its components.  Using "/\s+/" alone won't work, because spaces
       are not required between dashes, or a word or a dash. Additional places for a split are
       established by looking ahead and behind:

           $str = "one two - --6-8";
           @toks = split / \s+              # a run of spaces
                         | (?<=\S) (?=-)    # any non-space followed by '-'
                         | (?<=-)  (?=\S)   # a '-' followed by any non-space
                         /x, $str;          # @toks = qw(one two - - - 6 - 8)

   Using independent subexpressions to prevent backtracking
       Independent subexpressions (or atomic subexpressions) are regular expressions, in the
       context of a larger regular expression, that function independently of the larger regular
       expression.  That is, they consume as much or as little of the string as they wish without
       regard for the ability of the larger regexp to match.  Independent subexpressions are
       represented by "(?>regexp)" or (starting in 5.32, experimentally in 5.28)
       "(*atomic:regexp)".  We can illustrate their behavior by first considering an ordinary
       regexp:

           $x = "ab";
           $x =~ /a*ab/;  # matches

       This obviously matches, but in the process of matching, the subexpression "a*" first
       grabbed the 'a'.  Doing so, however, wouldn't allow the whole regexp to match, so after
       backtracking, "a*" eventually gave back the 'a' and matched the empty string.  Here, what
       "a*" matched was dependent on what the rest of the regexp matched.

       Contrast that with an independent subexpression:

           $x =~ /(?>a*)ab/;  # doesn't match!

       The independent subexpression "(?>a*)" doesn't care about the rest of the regexp, so it
       sees an 'a' and grabs it.  Then the rest of the regexp "ab" cannot match.  Because
       "(?>a*)" is independent, there is no backtracking and the independent subexpression does
       not give up its 'a'.  Thus the match of the regexp as a whole fails.  A similar behavior
       occurs with completely independent regexps:

           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here "/g" and "\G" create a "tag team" handoff of the string from one regexp to the other.
       Regexps with an independent subexpression are much like this, with a handoff of the string
       to the independent subexpression, and a handoff of the string back to the enclosing
       regexp.

       The ability of an independent subexpression to prevent backtracking can be quite useful.
       Suppose we want to match a non-empty string enclosed in parentheses up to two levels deep.
       Then the following regexp matches:

           $x = "abc(de(fg)h";  # unbalanced parentheses
           $x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;

       The regexp matches an open parenthesis, one or more copies of an alternation, and a close
       parenthesis.  The alternation is two-way, with the first alternative "[^()]+" matching a
       substring with no parentheses and the second alternative "\([^()]*\)"  matching a
       substring delimited by parentheses.  The problem with this regexp is that it is
       pathological: it has nested indeterminate quantifiers of the form "(a+|b)+".  We discussed
       in Part 1 how nested quantifiers like this could take an exponentially long time to
       execute if no match were possible.  To prevent the exponential blowup, we need to prevent
       useless backtracking at some point.  This can be done by enclosing the inner quantifier as
       an independent subexpression:

           $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;

       Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by gobbling up as much of
       the string as possible and keeping it.   Then match failures fail much more quickly.

   Conditional expressions
       A conditional expression is a form of if-then-else statement that allows one to choose
       which patterns are to be matched, based on some condition.  There are two types of
       conditional expression: "(?(condition)yes-regexp)" and
       "(?(condition)yes-regexp|no-regexp)".  "(?(condition)yes-regexp)" is like an 'if(){}'
       statement in Perl.  If the condition is true, the yes-regexp will be matched.  If the
       condition is false, the yes-regexp will be skipped and Perl will move onto the next regexp
       element.  The second form is like an 'if(){}else{}' statement in Perl.  If the condition
       is true, the yes-regexp will be matched, otherwise the no-regexp will be matched.

       The condition can have several forms.  The first form is simply an integer in parentheses
       "(integer)".  It is true if the corresponding backreference "\integer" matched earlier in
       the regexp.  The same thing can be done with a name associated with a capture group,
       written as "(<name>)" or "('name')".  The second form is a bare zero-width assertion
       "(?...)", either a lookahead, a lookbehind, or a code assertion (discussed in the next
       section).  The third set of forms provides tests that return true if the expression is
       executed within a recursion ("(R)") or is being called from some capturing group,
       referenced either by number ("(R1)", "(R2)",...) or by name ("(R&name)").

       The integer or name form of the "condition" allows us to choose, with more flexibility,
       what to match based on what matched earlier in the regexp. This searches for words of the
       form "$x$x" or "$x$y$y$x":

           % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...
           toot
           toto
           tutu

       The lookbehind "condition" allows, along with backreferences, an earlier part of the match
       to influence a later part of the match.  For instance,

           /[ATGC]+(?(?<=AA)G|C)$/;

       matches a DNA sequence such that it either ends in "AAG", or some other base pair
       combination and 'C'.  Note that the form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for
       the lookahead, lookbehind or code assertions, the parentheses around the conditional are
       not needed.

   Defining named patterns
       Some regular expressions use identical subpatterns in several places.  Starting with Perl
       5.10, it is possible to define named subpatterns in a section of the pattern so that they
       can be called up by name anywhere in the pattern.  This syntactic pattern for this
       definition group is "(?(DEFINE)(?<name>pattern)...)".  An insertion of a named pattern is
       written as "(?&name)".

       The example below illustrates this feature using the pattern for floating point numbers
       that was presented earlier on.  The three subpatterns that are used more than once are the
       optional sign, the digit sequence for an integer and the decimal fraction.  The "DEFINE"
       group at the end of the pattern contains their definition.  Notice that the decimal
       fraction pattern is the first place where we can reuse the integer pattern.

          /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
             (?: [eE](?&osg)(?&int) )?
           $
           (?(DEFINE)
             (?<osg>[-+]?)         # optional sign
             (?<int>\d++)          # integer
             (?<dec>\.(?&int))     # decimal fraction
           )/x

   Recursive patterns
       This feature (introduced in Perl 5.10) significantly extends the power of Perl's pattern
       matching.  By referring to some other capture group anywhere in the pattern with the
       construct "(?group-ref)", the pattern within the referenced group is used as an
       independent subpattern in place of the group reference itself.  Because the group
       reference may be contained within the group it refers to, it is now possible to apply
       pattern matching to tasks that hitherto required a recursive parser.

       To illustrate this feature, we'll design a pattern that matches if a string contains a
       palindrome. (This is a word or a sentence that, while ignoring spaces, interpunctuation
       and case, reads the same backwards as forwards. We begin by observing that the empty
       string or a string containing just one word character is a palindrome. Otherwise it must
       have a word character up front and the same at its end, with another palindrome in
       between.

        /(?: (\w) (?...Here be a palindrome...) \g{ -1 } | \w? )/x

       Adding "\W*" at either end to eliminate what is to be ignored, we already have the full
       pattern:

           my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
           for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
               print "'$s' is a palindrome\n" if $s =~ /$pp/;
           }

       In "(?...)" both absolute and relative backreferences may be used.  The entire pattern can
       be reinserted with "(?R)" or "(?0)".  If you prefer to name your groups, you can use
       "(?&name)" to recurse into that group.

   A bit of magic: executing Perl code in a regular expression
       Normally, regexps are a part of Perl expressions.  Code evaluation expressions turn that
       around by allowing arbitrary Perl code to be a part of a regexp.  A code evaluation
       expression is denoted "(?{code})", with code a string of Perl statements.

       Code expressions are zero-width assertions, and the value they return depends on their
       environment.  There are two possibilities: either the code expression is used as a
       conditional in a conditional expression "(?(condition)...)", or it is not.  If the code
       expression is a conditional, the code is evaluated and the result (i.e., the result of the
       last statement) is used to determine truth or falsehood.  If the code expression is not
       used as a conditional, the assertion always evaluates true and the result is put into the
       special variable $^R.  The variable $^R can then be used in code expressions later in the
       regexp.  Here are some silly examples:

           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'

       Pay careful attention to the next example:

           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?

       At first glance, you'd think that it shouldn't print, because obviously the "ddd" isn't
       going to match the target string. But look at this example:

           $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
                                                   # but _does_ print

       Hmm. What happened here? If you've been following along, you know that the above pattern
       should be effectively (almost) the same as the last one; enclosing the 'd' in a character
       class isn't going to change what it matches. So why does the first not print while the
       second one does?

       The answer lies in the optimizations the regexp engine makes. In the first case, all the
       engine sees are plain old characters (aside from the "?{}" construct). It's smart enough
       to realize that the string 'ddd' doesn't occur in our target string before actually
       running the pattern through. But in the second case, we've tricked it into thinking that
       our pattern is more complicated. It takes a look, sees our character class, and decides
       that it will have to actually run the pattern to determine whether or not it matches, and
       in the process of running it hits the print statement before it discovers that we don't
       have a match.

       To take a closer look at how the engine does optimizations, see the section "Pragmas and
       debugging" below.

       More fun with "?{}":

           $x =~ /(?{print "Hi Mom!";})/;         # matches,
                                                  # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'

       The bit of magic mentioned in the section title occurs when the regexp backtracks in the
       process of searching for a match.  If the regexp backtracks over a code expression and if
       the variables used within are localized using "local", the changes in the variables
       produced by the code expression are undone! Thus, if we wanted to count how many times a
       character got matched inside a group, we could use, e.g.,

           $x = "aaaa";
           $count = 0;  # initialize 'a' count
           $c = "bob";  # test if $c gets clobbered
           $x =~ /(?{local $c = 0;})         # initialize count
                  ( a                        # match 'a'
                    (?{local $c = $c + 1;})  # increment count
                  )*                         # do this any number of times,
                  aa                         # but match 'aa' at the end
                  (?{$count = $c;})          # copy local $c var into $count
                 /x;
           print "'a' count is $count, \$c variable is '$c'\n";

       This prints

           'a' count is 2, $c variable is 'bob'

       If we replace the "(?{local$c=$c+1;})" with "(?{$c=$c+1;})", the variable changes are not
       undone during backtracking, and we get

           'a' count is 4, $c variable is 'bob'

       Note that only localized variable changes are undone.  Other side effects of code
       expression execution are permanent.  Thus

           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

          Yow
          Yow
          Yow
          Yow

       The result $^R is automatically localized, so that it will behave properly in the presence
       of backtracking.

       This example uses a code expression in a conditional to match a definite article, either
       'the' in English or 'der|die|das' in German:

           $lang = 'DE';  # use German
           ...
           $text = "das";
           print "matched\n"
               if $text =~ /(?(?{
                                 $lang eq 'EN'; # is the language English?
                                })
                              the |             # if so, then match 'the'
                              (der|die|das)     # else, match 'der|die|das'
                            )
                           /xi;

       Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not
       "(?((?{...}))yes-regexp|no-regexp)".  In other words, in the case of a code expression, we
       don't need the extra parentheses around the conditional.

       If you try to use code expressions where the code text is contained within an interpolated
       variable, rather than appearing literally in the pattern, Perl may surprise you:

           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compiles ok, $bar interpolated
           /foo${pat}bar/;      # compile error!

           $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
           /foo${pat}bar/;      # compiles ok

       If a regexp has a variable that interpolates a code expression, Perl treats the regexp as
       an error. If the code expression is precompiled into a variable, however, interpolating is
       ok. The question is, why is this an error?

       The reason is that variable interpolation and code expressions together pose a security
       risk.  The combination is dangerous because many programmers who write search engines
       often take user input and plug it directly into a regexp:

           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp

       If the $regexp variable contains a code expression, the user could then execute arbitrary
       Perl code.  For instance, some joker could search for "system('rm-rf*');" to erase your
       files.  In this sense, the combination of interpolation and code expressions taints your
       regexp.  So by default, using both interpolation and code expressions in the same regexp
       is not allowed.  If you're not concerned about malicious users, it is possible to bypass
       this security check by invoking "usere'eval'":

           use re 'eval';       # throw caution out the door
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo${pat}bar/;      # compiles ok

       Another form of code expression is the pattern code expression.  The pattern code
       expression is like a regular code expression, except that the result of the code
       evaluation is treated as a regular expression and matched immediately.  A simple example
       is

           $length = 5;
           $char = 'a';
           $x = 'aaaaabb';
           $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

       This final example contains both ordinary and pattern code expressions.  It detects
       whether a binary string 1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,...  of the
       '1''s:

           $x = "1101010010001000001";
           $z0 = ''; $z1 = '0';   # initial conditions
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (?:
                              ((??{ $z0 })) # match some '0'
                              1             # and then a '1'
                              (?{ $z0 = $z1; $z1 .= $^N; })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           printf "Largest sequence matched was %d\n", length($z1)-length($z0);

       Remember that $^N is set to whatever was matched by the last completed capture group. This
       prints

           It is a Fibonacci sequence
           Largest sequence matched was 5

       Ha! Try that with your garden variety regexp package...

       Note that the variables $z0 and $z1 are not substituted when the regexp is compiled, as
       happens for ordinary variables outside a code expression.  Rather, the whole code block is
       parsed as perl code at the same time as perl is compiling the code containing the literal
       regexp pattern.

       This regexp without the "/x" modifier is

           /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

       which shows that spaces are still possible in the code parts. Nevertheless, when working
       with code and conditional expressions, the extended form of regexps is almost necessary in
       creating and debugging regexps.

   Backtracking control verbs
       Perl 5.10 introduced a number of control verbs intended to provide detailed control over
       the backtracking process, by directly influencing the regexp engine and by providing
       monitoring techniques.  See "Special Backtracking Control Verbs" in perlre for a detailed
       description.

       Below is just one example, illustrating the control verb "(*FAIL)", which may be
       abbreviated as "(*F)". If this is inserted in a regexp it will cause it to fail, just as
       it would at some mismatch between the pattern and the string. Processing of the regexp
       continues as it would after any "normal" failure, so that, for instance, the next position
       in the string or another alternative will be tried. As failing to match doesn't preserve
       capture groups or produce results, it may be necessary to use this in combination with
       embedded code.

          %count = ();
          "supercalifragilisticexpialidocious" =~
              /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
          printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

       The pattern begins with a class matching a subset of letters.  Whenever this matches, a
       statement like "$count{'a'}++;" is executed, incrementing the letter's counter. Then
       "(*FAIL)" does what it says, and the regexp engine proceeds according to the book: as long
       as the end of the string hasn't been reached, the position is advanced before looking for
       another vowel. Thus, match or no match makes no difference, and the regexp engine proceeds
       until the entire string has been inspected.  (It's remarkable that an alternative solution
       using something like

          $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
          printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

       is considerably slower.)

   Pragmas and debugging
       Speaking of debugging, there are several pragmas available to control and debug regexps in
       Perl.  We have already encountered one pragma in the previous section, "usere'eval';",
       that allows variable interpolation and code expressions to coexist in a regexp.  The other
       pragmas are

           use re 'taint';
           $tainted = <>;
           @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

       The "taint" pragma causes any substrings from a match with a tainted variable to be
       tainted as well.  This is not normally the case, as regexps are often used to extract the
       safe bits from a tainted variable.  Use "taint" when you are not extracting safe bits, but
       are performing some other processing.  Both "taint" and "eval" pragmas are lexically
       scoped, which means they are in effect only until the end of the block enclosing the
       pragmas.

           use re '/m';  # or any other flags
           $multiline_string =~ /^foo/; # /m is implied

       The "re '/flags'" pragma (introduced in Perl 5.14) turns on the given regular expression
       flags until the end of the lexical scope.  See "'/flags' mode" in re for more detail.

           use re 'debug';
           /^(.*)$/s;       # output debugging info

           use re 'debugcolor';
           /^(.*)$/s;       # output debugging info in living color

       The global "debug" and "debugcolor" pragmas allow one to get detailed debugging info about
       regexp compilation and execution.  "debugcolor" is the same as debug, except the debugging
       information is displayed in color on terminals that can display termcap color sequences.
       Here is example output:

           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0
           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       If you have gotten this far into the tutorial, you can probably guess what the different
       parts of the debugging output tell you.  The first part

           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)

       describes the compilation stage.  STAR(4) means that there is a starred object, in this
       case 'a', and if it matches, goto line 4, i.e., PLUS(7).  The middle lines describe some
       heuristics and optimizations performed before a match:

           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0

       Then the match is executed and the remaining lines describe the process:

           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       Each step is of the form "n<x><y>", with "<x>" the part of the string matched and "<y>"
       the part not yet matched.  The "|1:STAR" says that Perl is at line number 1 in the
       compilation list above.  See "Debugging Regular Expressions" in perldebguts for much more
       detail.

       An alternative method of debugging regexps is to embed "print" statements within the
       regexp.  This provides a blow-by-blow account of the backtracking in an alternation:

           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;

       prints

           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4

SEE ALSO
       This is just a tutorial.  For the full story on Perl regular expressions, see the perlre
       regular expressions reference page.

       For more information on the matching "m//" and substitution "s///" operators, see "Regexp
       Quote-Like Operators" in perlop.  For information on the "split" operation, see "split" in
       perlfunc.

       For an excellent all-around resource on the care and feeding of regular expressions, see
       the book Mastering Regular Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
       1556592-257-3).

AUTHOR AND COPYRIGHT
       Copyright (c) 2000 Mark Kvale.  All rights reserved.  Now maintained by Perl porters.

       This document may be distributed under the same terms as Perl itself.

   Acknowledgments
       The inspiration for the stop codon DNA example came from the ZIP code example in chapter 7
       of Mastering Regular Expressions.

       The author would like to thank Jeff Pinyan, Andrew Johnson, Peter Haworth, Ronald J
       Kimball, and Joe Smith for all their helpful comments.

perl v5.34.0                                2025-07-25                               PERLRETUT(1)

Generated by $Id: phpMan.php,v 4.55 2007/09/05 04:42:51 chedong Exp $ Author: Che Dong
On Apache
Under GNU General Public License
2026-02-18 14:04 @18.97.14.90 CrawledBy CCBot/2.0 (https://commoncrawl.org/faq/)
Valid XHTML 1.0!Valid CSS!